The SFT-1 and OXA-1 respiratory chain complex assembly factors influence lifespan by distinct mechanisms in
Biochemistry Department, University of Oxford, South Parks Road, Oxford, OX1 3QU, UK
Present address: CRUK London Research Institute, 44 Lincoln’s Inn Fields, London, WC2A 3LY, UK
Present address: Cytogenetics Department, South East Scotland Genetics Service, Western General Hospital, Edinburgh, UK
Abstract
Background
Results
RNAi of both of these genes in
Conclusions
This study further delineates the consequences of mitochondrial dysfunction within a whole organism that will ultimately help provide new models for human mitochondrial-associated diseases. The difference in phenotype observed upon down-regulation of these two COX assembly factors, as well as phenotypic differences between these factors and other respiratory chain components analyzed thus far, illustrates the complex inter-relationships that exist among energy metabolism, reproduction and aging even in this simplest of metazoan model organisms.
Background
Defects in mitochondrial function are implicated in a wide range of human diseases, affecting both development and the maintenance of normal structure and function
The nematode worm,
One of the most striking findings is that different mitochondrial defects, which result in comparable levels of impairment of energy generation, can have opposite effects on lifespan. For example, mutation in the
In contrast, the complex I subunit mutant
In this study, we compare the consequences of the deficiency of two mitochondrial respiratory chain assembly factors, the protein products of the
The human
Although both SURF1/SFT-1 and OXA-1 are components of the inner mitochondrial membrane that function in the assembly of respiratory chain complexes, the consequences of
Results
Decreased brood size in
Figure 1
Increased lifespan in
Cumulative survival curves of the F1 offspring of injected
Figure 2
Lifespan extension in
Lifespan extension in
Additional file 1
Lifespan extension in
Click here for file
To ascertain whether the lifespan extension was dependent on the
In the case of
It has previously been reported that, in the case of genes involved in mitochondrial function, the dose of dsRNA delivered to
Response to oxidative stress following
To investigate whether the lifespan extension was associated with resistance to oxidative stress,
The resistance to oxidative stress of the
Figure 3
Sensitivity of
Sensitivity of
Additional file 2
Sensitivity of
Click here for file
Additional file 3
Resistance of
Click here for file
OXA-1 and SFT-1 tissue distributions
oxa-1::GFP
The expression pattern of a translational
Figure 4
sft-1::gfp
The
Additional file 4
Click here for file
Discussion
Cytochrome oxidase deficiency generated by RNAi of
The embryonic lethality and slow growth of viable progeny observed with RNAi of
Decreased fecundity of
Both
In nearly all cases examined thus far, lifespan extension in Mit mutants has been shown to act independently of the insulin/IGF signaling pathway
The second model for the determination of lifespan in
On the other hand, mutants such as
“Oxidative stress resistance” is rather an umbrella term, as different Mit mutants display different sensitivities to a spectrum of oxidative stresses. For example, in one study of 10 different mutant/RNAi strains, most of the long-lived worms with compromised mitochondria displayed marked resistance to hydrogen peroxide, yet were not resistant (or even displayed increased sensitivity) to paraquat
It has been previously suggested that long-lived Mit mutants utilize a novel metabolism, and that longevity in these animals may be dependent on this altered metabolic state. For example, it has been proposed, albeit using a limited number of mutants, that long-lived Mit mutants up-regulate fermentative malate dismutation, where fumarate is terminally reduced at complex II to succinate, generating fewer radical species overall
Strikingly, mitochondrial respiratory complex dysfunction models being developed in other systems display many of the same features as
Whatever the precise mechanisms, it is clear that
Conclusions
We have clearly shown that knockdown of
Methods
Experiments were performed with the wild-type (WT) Bristol strain N2 and
Bioinformatic analysis
Homologs were identified by BLAST analysis (
RNAi by injection
PCR primers specific for
dsRNA was synthesized directly from PCR products as previously described
RNAi by feeding
L3 N2 (or
RT-PCR
Reduction of the target transcripts following RNAi treatment was confirmed by gene-specific RT-PCR using the Superscript III RT system (Life Technologies (Invitrogen Division). Renfrew, Paisley, UK) with RNA from 20 L4 progeny from
Specific
Brood counts
Brood sizes were assessed using 20 synchronized L4 worms each injected with dsRNA corresponding to
Cytochrome oxidase (COX) staining
COX activity was assayed in cells of intact worms by the oxidation of diaminobenzidine in the presence of cytochrome c in a protocol adapted from Seligman
Determination of lifespan
Lifespan assays were performed using 20 to 50 worms for each strain (or F1 progeny of animals that had been injected with dsRNA corresponding to
Sensitivity to oxidative stress
Oxidative stress sensitivity assays were performed using 50 worms for each strain (or F1 progeny of animals that had been injected with dsRNA corresponding to
A 6,870 bp fragment containing the
To fuse the gene specific PCR products to the GFP reporter, 0.5 μL of each PCR product and 0.5 μL of gel purified GFP PCR product (1.8 kb fragment, the product of PCR with primers ppdgfp and gfp c1 from plasmid pPD95.75 (Fire Lab vectors obtained from Addgene, Cambridge, MA, USA) were added to the Expand Long Buffer 3 system reaction mix to form the template for the sewing reaction. A second forward nested primer and GFP specific reverse primer (gfp c2) were used to amplify the full-length gene-GFP fused PCR product. These products were gel purified using the SYBR-RED gel purification system.
ppdgfp primer 5’GCTTGCATGCCTGCAGGTCG3’
gfp c1 primer 5’AAGGGCCCGTACGGCCGACTAGTAGG3’
gfp c2 primer 5’AAACAGTTATGTTTGGTATATTGGG3’
The purified PCR products were cloned into the TOPO XL vector using the TOPO XL cloning kit (Invitrogen) and shown to contain the correct inserts by restriction digest and sequencing. The
Transgenic worms
GFP reporter constructs were injected into the syncytial gonad of young adult hermaphrodite worms at a concentration of approximately 20 ng/μL as described
Mitotracker staining
L4 stage N2 and AW241 worms were transferred to seeded NGM plates with 2 μg/ml Mitotracker Red (Life Technologies Ltd (Invitrogen division, Renfrew, Paisley, UK) spread on the surface and stored in the dark. L4 progeny from these animals were picked, washed in M9 for one hour and mounted for fluorescence microscopy as described above.
Abbreviations
COX: Cytochrome oxidase; MIT: Mitochondrial; NGM: Nematode growth media; PBS: Phosphate-buffered saline; ROS`: Reactive oxygen species.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SM, JH, CB and PA carried out the brood size, life span and oxidative stress assays. RB and CD performed the COX staining experiments, and SM, JH and RB constructed and analyzed the GFP expression patterns. GB and AW conceived of the study, participated in its design and coordination, and wrote the manuscript. All authors read and approved the final manuscript.
Acknowledgements
Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources (NCRR). This work was funded by grants to AW from the MRC (G0001282, and a Capacity Building Studentship) and to GB from the Wellcome Trust.
The neurological presentations of childhood and adult mitochondrial disease: established syndromes and phenotypic variations
Knockdown of human COX17 affects assembly and supramolecular organization of cytochrome c oxidase
SURF1, encoding a factor involved in the biogenesis of cytochrome c oxidase, is mutated in Leigh syndrome
OXA1, a
Long-lived
Bacteria, yeast, worms, and flies: exploiting simple model organisms to investigate human mitochondrial diseases
Reactive oxygen species and aging in
Relationship between mitochondrial electron transport chain dysfunction, development, and life extension in
Mitochondrial electron transport is a key determinant of life span in
Altered quinone biosynthesis in the long-lived clk-1 mutants of
A systematic RNAi screen identifies a critical role for mitochondria in
Mitochondrial respiratory chain deficiency in
Rates of behavior and aging specified by mitochondrial function during development
A systematic RNAi screen for longevity genes in
The effects of complex i function and oxidative damage on lifespan and anesthetic sensitivity in
Long-lived mitochondrial (Mit) mutants of
Decreased energy metabolism extends life span in
Inhibition of respiration extends
A mitochondrial superoxide signal triggers increased longevity in
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in
Regulation of life span by mitochondrial respiration: the HIF-1 and ROS connection
How increased oxidative stress promotes longevity and metabolic health: the concept of mitochondrial hormesis (mitohormesis)
Mutations of SURF-1 in Leigh disease associated with cytochrome c oxidase deficiency
Characterization of SURF-1 expression and Surf-1p function in normal and disease conditions
Yeast Oxa1 interacts with mitochondrial ribosomes: the importance of the C-terminal region of Oxa1
A
The age-1 and daf-2 genes function in a common pathway to control the lifespan of
A methyl viologen-sensitive mutant of the nematode
A global analysis of
The respiratory gene OXA1 has two fission yeast orthologues which together encode a function essential for cellular viability
Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in
The
Roles of Oxa1-related inner-membrane translocases in assembly of respiratory chain complexes
Rate of aerobic metabolism and superoxide production rate potential in the nematode
Intermediary metabolism
Transgene-mediated cosuppression in the
The genetics of caloric restriction in
CLK-1 controls respiration, behavior and aging in the nematode
Worming pathways to and from DAF-16/FOXO
A mutation in succinate dehydrogenase cytochrome b causes oxidative stress and ageing in nematodes
The role of mitochondria in the life of the nematode,
Extending life span by increasing oxidative stress
Glucose restriction extends
Two modes of mitochondrial dysfunction lead independently to lifespan extension in
Mitochondrial dysfunction in
Increased longevity of some
A regulated response to impaired respiration slows behavioral rates and increases lifespan in
Early mitochondrial dysfunction in long-lived Mclk1+/− mice
Increased longevity and refractoriness to Ca(2+)-dependent neurodegeneration in Surf1 knockout mice
Post-transcriptional silencing and functional characterization of the
Methods
Potent and specific genetic interference by double-stranded RNA in
DNA transformation
Genome-wide RNAi screening in
Systematic functional analysis of the
The retroviruses human immunodeficiency virus type 1 and Moloney murine leukemia virus adopt radically different strategies to regulate promoter-proximal polyadenylation
Nondroplet ultrastructural demonstration of cytochrome oxidase activity with a polymerizing osmiophilic reagent, diaminobenzidine (DAB)
PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic
OASIS: online application for the survival analysis of lifespan assays performed in aging research
The SFT-1 and OXA-1 respiratory chain complex assembly factors influence lifespan by distinct mechanisms in
Biochemistry Department, University of Oxford, South Parks Road, Oxford, OX1 3QU, UK
Present address: CRUK London Research Institute, 44 Lincoln’s Inn Fields, London, WC2A 3LY, UK
Present address: Cytogenetics Department, South East Scotland Genetics Service, Western General Hospital, Edinburgh, UK
Abstract
Background
Results
RNAi of both of these genes in
Conclusions
This study further delineates the consequences of mitochondrial dysfunction within a whole organism that will ultimately help provide new models for human mitochondrial-associated diseases. The difference in phenotype observed upon down-regulation of these two COX assembly factors, as well as phenotypic differences between these factors and other respiratory chain components analyzed thus far, illustrates the complex inter-relationships that exist among energy metabolism, reproduction and aging even in this simplest of metazoan model organisms.
Background
Defects in mitochondrial function are implicated in a wide range of human diseases, affecting both development and the maintenance of normal structure and function
The nematode worm,
One of the most striking findings is that different mitochondrial defects, which result in comparable levels of impairment of energy generation, can have opposite effects on lifespan. For example, mutation in the
In contrast, the complex I subunit mutant
In this study, we compare the consequences of the deficiency of two mitochondrial respiratory chain assembly factors, the protein products of the
The human
Although both SURF1/SFT-1 and OXA-1 are components of the inner mitochondrial membrane that function in the assembly of respiratory chain complexes, the consequences of
Results
Decreased brood size in
Figure 1
Increased lifespan in
Cumulative survival curves of the F1 offspring of injected
Figure 2
Lifespan extension in
Lifespan extension in
Additional file 1
Lifespan extension in
Click here for file
To ascertain whether the lifespan extension was dependent on the
In the case of
It has previously been reported that, in the case of genes involved in mitochondrial function, the dose of dsRNA delivered to
Response to oxidative stress following
To investigate whether the lifespan extension was associated with resistance to oxidative stress,
The resistance to oxidative stress of the
Figure 3
Sensitivity of
Sensitivity of
Additional file 2
Sensitivity of
Click here for file
Additional file 3
Resistance of
Click here for file
OXA-1 and SFT-1 tissue distributions
oxa-1::GFP
The expression pattern of a translational
Figure 4
sft-1::gfp
The
Additional file 4
Click here for file
Discussion
Cytochrome oxidase deficiency generated by RNAi of
The embryonic lethality and slow growth of viable progeny observed with RNAi of
Decreased fecundity of
Both
In nearly all cases examined thus far, lifespan extension in Mit mutants has been shown to act independently of the insulin/IGF signaling pathway
The second model for the determination of lifespan in
On the other hand, mutants such as
“Oxidative stress resistance” is rather an umbrella term, as different Mit mutants display different sensitivities to a spectrum of oxidative stresses. For example, in one study of 10 different mutant/RNAi strains, most of the long-lived worms with compromised mitochondria displayed marked resistance to hydrogen peroxide, yet were not resistant (or even displayed increased sensitivity) to paraquat
It has been previously suggested that long-lived Mit mutants utilize a novel metabolism, and that longevity in these animals may be dependent on this altered metabolic state. For example, it has been proposed, albeit using a limited number of mutants, that long-lived Mit mutants up-regulate fermentative malate dismutation, where fumarate is terminally reduced at complex II to succinate, generating fewer radical species overall
Strikingly, mitochondrial respiratory complex dysfunction models being developed in other systems display many of the same features as
Whatever the precise mechanisms, it is clear that
Conclusions
We have clearly shown that knockdown of
Methods
Experiments were performed with the wild-type (WT) Bristol strain N2 and
Bioinformatic analysis
Homologs were identified by BLAST analysis (
RNAi by injection
PCR primers specific for
dsRNA was synthesized directly from PCR products as previously described
RNAi by feeding
L3 N2 (or
RT-PCR
Reduction of the target transcripts following RNAi treatment was confirmed by gene-specific RT-PCR using the Superscript III RT system (Life Technologies (Invitrogen Division). Renfrew, Paisley, UK) with RNA from 20 L4 progeny from
Specific
Brood counts
Brood sizes were assessed using 20 synchronized L4 worms each injected with dsRNA corresponding to
Cytochrome oxidase (COX) staining
COX activity was assayed in cells of intact worms by the oxidation of diaminobenzidine in the presence of cytochrome c in a protocol adapted from Seligman
Determination of lifespan
Lifespan assays were performed using 20 to 50 worms for each strain (or F1 progeny of animals that had been injected with dsRNA corresponding to
Sensitivity to oxidative stress
Oxidative stress sensitivity assays were performed using 50 worms for each strain (or F1 progeny of animals that had been injected with dsRNA corresponding to
A 6,870 bp fragment containing the
To fuse the gene specific PCR products to the GFP reporter, 0.5 μL of each PCR product and 0.5 μL of gel purified GFP PCR product (1.8 kb fragment, the product of PCR with primers ppdgfp and gfp c1 from plasmid pPD95.75 (Fire Lab vectors obtained from Addgene, Cambridge, MA, USA) were added to the Expand Long Buffer 3 system reaction mix to form the template for the sewing reaction. A second forward nested primer and GFP specific reverse primer (gfp c2) were used to amplify the full-length gene-GFP fused PCR product. These products were gel purified using the SYBR-RED gel purification system.
ppdgfp primer 5’GCTTGCATGCCTGCAGGTCG3’
gfp c1 primer 5’AAGGGCCCGTACGGCCGACTAGTAGG3’
gfp c2 primer 5’AAACAGTTATGTTTGGTATATTGGG3’
The purified PCR products were cloned into the TOPO XL vector using the TOPO XL cloning kit (Invitrogen) and shown to contain the correct inserts by restriction digest and sequencing. The
Transgenic worms
GFP reporter constructs were injected into the syncytial gonad of young adult hermaphrodite worms at a concentration of approximately 20 ng/μL as described
Mitotracker staining
L4 stage N2 and AW241 worms were transferred to seeded NGM plates with 2 μg/ml Mitotracker Red (Life Technologies Ltd (Invitrogen division, Renfrew, Paisley, UK) spread on the surface and stored in the dark. L4 progeny from these animals were picked, washed in M9 for one hour and mounted for fluorescence microscopy as described above.
Abbreviations
COX: Cytochrome oxidase; MIT: Mitochondrial; NGM: Nematode growth media; PBS: Phosphate-buffered saline; ROS`: Reactive oxygen species.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SM, JH, CB and PA carried out the brood size, life span and oxidative stress assays. RB and CD performed the COX staining experiments, and SM, JH and RB constructed and analyzed the GFP expression patterns. GB and AW conceived of the study, participated in its design and coordination, and wrote the manuscript. All authors read and approved the final manuscript.
Acknowledgements
Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources (NCRR). This work was funded by grants to AW from the MRC (G0001282, and a Capacity Building Studentship) and to GB from the Wellcome Trust.
The neurological presentations of childhood and adult mitochondrial disease: established syndromes and phenotypic variations
Knockdown of human COX17 affects assembly and supramolecular organization of cytochrome c oxidase
SURF1, encoding a factor involved in the biogenesis of cytochrome c oxidase, is mutated in Leigh syndrome
OXA1, a
Long-lived
Bacteria, yeast, worms, and flies: exploiting simple model organisms to investigate human mitochondrial diseases
Reactive oxygen species and aging in
Relationship between mitochondrial electron transport chain dysfunction, development, and life extension in
Mitochondrial electron transport is a key determinant of life span in
Altered quinone biosynthesis in the long-lived clk-1 mutants of
A systematic RNAi screen identifies a critical role for mitochondria in
Mitochondrial respiratory chain deficiency in
Rates of behavior and aging specified by mitochondrial function during development
A systematic RNAi screen for longevity genes in
The effects of complex i function and oxidative damage on lifespan and anesthetic sensitivity in
Long-lived mitochondrial (Mit) mutants of
Decreased energy metabolism extends life span in
Inhibition of respiration extends
A mitochondrial superoxide signal triggers increased longevity in
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in
Regulation of life span by mitochondrial respiration: the HIF-1 and ROS connection
How increased oxidative stress promotes longevity and metabolic health: the concept of mitochondrial hormesis (mitohormesis)
Mutations of SURF-1 in Leigh disease associated with cytochrome c oxidase deficiency
Characterization of SURF-1 expression and Surf-1p function in normal and disease conditions
Yeast Oxa1 interacts with mitochondrial ribosomes: the importance of the C-terminal region of Oxa1
A
The age-1 and daf-2 genes function in a common pathway to control the lifespan of
A methyl viologen-sensitive mutant of the nematode
A global analysis of
The respiratory gene OXA1 has two fission yeast orthologues which together encode a function essential for cellular viability
Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in
The
Roles of Oxa1-related inner-membrane translocases in assembly of respiratory chain complexes
Rate of aerobic metabolism and superoxide production rate potential in the nematode
Intermediary metabolism
Transgene-mediated cosuppression in the
The genetics of caloric restriction in
CLK-1 controls respiration, behavior and aging in the nematode
Worming pathways to and from DAF-16/FOXO
A mutation in succinate dehydrogenase cytochrome b causes oxidative stress and ageing in nematodes
The role of mitochondria in the life of the nematode,
Extending life span by increasing oxidative stress
Glucose restriction extends
Two modes of mitochondrial dysfunction lead independently to lifespan extension in
Mitochondrial dysfunction in
Increased longevity of some
A regulated response to impaired respiration slows behavioral rates and increases lifespan in
Early mitochondrial dysfunction in long-lived Mclk1+/− mice
Increased longevity and refractoriness to Ca(2+)-dependent neurodegeneration in Surf1 knockout mice
Post-transcriptional silencing and functional characterization of the
Methods
Potent and specific genetic interference by double-stranded RNA in
DNA transformation
Genome-wide RNAi screening in
Systematic functional analysis of the
The retroviruses human immunodeficiency virus type 1 and Moloney murine leukemia virus adopt radically different strategies to regulate promoter-proximal polyadenylation
Nondroplet ultrastructural demonstration of cytochrome oxidase activity with a polymerizing osmiophilic reagent, diaminobenzidine (DAB)
PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic
OASIS: online application for the survival analysis of lifespan assays performed in aging research